LAST Tutorial

LAST finds similar regions between sequences, and aligns them.

Example 1: Compare the human and fugu mitochondrial genomes

For our first example, we wish to find and align similar regions between the human and fugu mitochondrial genomes. You can find these sequences in the examples directory: humanMito.fa and fuguMito.fa. We can compare them like this:

lastdb -cR01 humdb humanMito.fa
lastal humdb fuguMito.fa > myalns.maf

The lastdb command creates several files whose names begin with "humdb". The lastal command then compares fuguMito.fa to the humdb files, and writes the alignments to a file called "myalns.maf".

The "-cR01" option suppresses alignments caused by simple sequence such as cacacacacacacacacacacaca.

Understanding the output

The output has very long lines, so you need to view it without line-wrapping. For example, with a Unix/Linux/MacOsX command line, you can use:

less -S myalns.maf

Each alignment looks like this:

a score=27 EG2=4.7e+04 E=2.6e-05
s humanMito 2170 145 + 16571 AGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTT...
s fuguMito  1648 142 + 16447 AGTAGGCTTAGAAGCAGCCACCA--CAAGAAAGCGTT...

The score is a measure of how significant the similarity is. EG2 and E are explained at last-evalues.html. Lines starting with "s" contain: the sequence name, the start coordinate of the alignment, the number of bases spanned by the alignment, the strand, the sequence length, and the aligned bases.

The start coordinates are zero-based. This means that, if the alignment begins right at the start of a sequence, the coordinate is 0. If the strand is "-", the start coordinate is in the reverse strand.

This alignment format is called MAF (multiple alignment format). You can convert it to several other formats using maf-convert. You can make lastal produce a few other formats with option -f (see lastal.html).

Example 2: Compare vertebrate proteins to invertebrate proteins

Use the lastdb -p option to indicate that the sequences are proteins:

lastdb -p -cR01 invdb invertebrate.fa
lastal invdb vertebrate.fa

Example 3: Compare DNA sequences to protein sequences

Here we use the -F15 option, to specify translated alignment with a score penalty of 15 for frameshifts:

lastdb -p -cR01 protdb proteins.fa
lastal -F15 protdb dnas.fa

Example 4: Find high-similarity, and short, protein alignments

LAST uses a scoring scheme to find similarities. Some scoring schemes are tuned for weak similarities, others for strong similarities. The PAM30 scoring scheme finds strong protein similarities:

lastdb -p -cR01 invdb invertebrate.fa
lastal -pPAM30 invdb vertebrate.fa

This has two advantages:

Example 5: Align human DNA sequences to the human genome

We can align human DNA sequences to the human genome like this:

lastdb -uNEAR -R01 humandb human/chr*.fa
lastal humandb queries.fa | last-split > myalns.maf

This will use about 15 gigabytes of memory.

Tuning speed, sensitivity, memory and disk usage

Example 6: Find very short DNA alignments

By default, LAST is quite strict, and only reports significant alignments that will rarely occur by chance. In the preceding example, the minimum alignment length is about 26 bases (less for smaller genomes). To find shorter alignments, we must down-tune the strictness:

lastdb -uNEAR -R01 humandb human/chr*.fa
lastal -D100 humandb queries.fa | last-split > myalns.maf

In this example, the minimum alignment length is about 20 bases (less for smaller genomes).

Example 7: Align human fastq sequences to the human genome

DNA sequences are not always perfectly accurate, and they are sometimes provided in fastq format, which indicates the reliability of each base. LAST can use this information to improve alignment accuracy. Option -Q1 indicates fastq-sanger format:

lastdb -uNEAR -R01 humandb human/chr*.fa
lastal -Q1 humandb queries.fastq | last-split > myalns.maf

Assumption: LAST assumes the reliabilities reflect substitution errors, not insertion/deletion errors. If that is not true, you can tell it to ignore the reliability data with -Q0.

Fastq format confusion

Unfortunately, there is more than one fastq format (see http://nar.oxfordjournals.org/content/38/6/1767.long). Recently (2013) fastq-sanger seems to be dominant, but if you have another variant you need to change the -Q option (see lastal.html).

Paired DNA reads

If you have paired DNA reads, there are two options:

  1. Use last-pair-probs (see last-pair-probs.html).

  2. Ignore the pairing information, and align the reads individually (using last-split as above). This may be useful because last-pair-probs does not currently allow different parts of one read to match different parts of the genome, though it does allow the two reads in a pair to match (e.g.) different chromosomes.

Example 8: Compare the human and mouse genomes

See here.

Example 9: Compare the human and chimp genomes

See here. But that recipe is extremely slow-and-accurate. You can tune it to compare huge, high-similarity genomes with moderate run time and memory use:

Example 10: Ambiguity of alignment columns

Consider this alignment:

TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
|||||||| ||||||  |  ||  | |  |    || ||||||   |||||||||||
TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG

The middle section has such weak similarity that its precise alignment cannot be confidently inferred.

It is sometimes useful to estimate the ambiguity of each column in an alignment. We can do that using lastal option -j4:

lastdb -cR01 humdb humanMito.fa
lastal -j4 humdb fuguMito.fa > myalns.maf

The output looks like this:

a score=17 EG2=9.3e+09 E=5e-06
s seqX 0 57 + 57 TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
s seqY 0 51 + 51 TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
p                %*.14442011.(%##"%$$$$###""!!!""""&'(*,340.,,.~~~~~~~~~~~

The "p" line indicates the probability that each column is wrongly aligned, using a compact code (the same as fastq-sanger format):

Symbol Error probability Symbol Error probability
! 0.79 -- 1 0 0.025 -- 0.032
" 0.63 -- 0.79 1 0.02 -- 0.025
# 0.5 -- 0.63 2 0.016 -- 0.02
$ 0.4 -- 0.5 3 0.013 -- 0.016
% 0.32 -- 0.4 4 0.01 -- 0.013
& 0.25 -- 0.32 5 0.0079 -- 0.01
' 0.2 -- 0.25 6 0.0063 -- 0.0079
( 0.16 -- 0.2 7 0.005 -- 0.0063
) 0.13 -- 0.16 8 0.004 -- 0.005
* 0.1 -- 0.13 9 0.0032 -- 0.004
+ 0.079 -- 0.1 : 0.0025 -- 0.0032
, 0.063 -- 0.079 ; 0.002 -- 0.0025
- 0.05 -- 0.063 < 0.0016 -- 0.002
. 0.04 -- 0.05 = 0.0013 -- 0.0016
/ 0.032 -- 0.04 > 0.001 -- 0.0013

Note that each alignment is grown from a "core" region, and the ambiguity estimates assume that the core is correctly aligned. The core is indicated by "~" symbols, and it contains exact matches only.

LAST has options to find alignments with optimal column probabilities, instead of optimal score: see lastal.html.