last-split

This program estimates "split alignments" (typically for DNA) or "spliced alignments" (typically for RNA).

It reads candidate alignments of query sequences to a genome, and looks for a unique best alignment for each part of each query. It allows different parts of one query to match different parts of the genome. This is useful for DNA queries that cross rearrangement breakpoints, or RNA queries that cross splice junctions.

Examples

Split alignment of DNA reads to a genome

Assume the DNA reads are in a file called "q.fastq" (in fastq-sanger format), and the genome is in "genome.fasta" (in fasta format). We can do the alignment like this:

lastdb -m1111110 db genome.fasta
lastal -Q1 -e120 db q.fastq | last-split > out.maf

Spliced alignment of RNA reads to a genome

This time, we provide the genome information to last-split, which causes it to do spliced instead of split alignment, and also tells it where the splice signals are (GT, AG, etc):

lastdb -m1111110 db genome.fasta
lastal -Q1 -e120 db q.fastq | last-split -g db > out.maf

This will favour splices starting at GT (and to a lesser extent GC and AT), and ending at AG (and to a lesser extent AC). However, it allows splices starting and ending anywhere. It also favours splices with introns of typical length, specified by a log-normal distribution (i.e. cis-splices). However, it allows arbitrary trans-splices between any two places in the genome. If you wish to turn off trans-splicing, add -t0 to the last-split options.

Unfortunately, the cis-splicing calculations can be slow, depending on various factors such as query sequence length. If it is too slow, please try the next recipe.

Faster trans-spliced alignment

Here we use -c0 to turn off cis-splicing, and -t0.004 to specify a higher probability of trans-splicing:

lastdb -m1111110 db genome.fasta
lastal -Q1 -e120 db q.fastq | last-split -c0 -t0.004 -g db > out.maf

Output

The output is in MAF(-like) format:

a score=150 mismap=0.000413
s chr21  15963638 25 + 48129895 TCAGATGAGGACCTAATTTATTACT
s query7       50 25 +       75 TCAGATGAGGACCTAATTTATTACT
q query7                        EBEEC@CE=EEE?FEDAED5?@@D@
p                               !#$'BBBBBBBBBBBBBBBBBBBBB

The "mismap" is the estimated probability that this part of the query should be aligned to a different part of the genome. The line starting with "p" indicates the probability that each base should be aligned to a different part of the genome. It uses a compact code:

Symbol Error probability Symbol Error probability

! 0.79 -- 1 0 0.025 -- 0.032

" 0.63 -- 0.79 1 0.02 -- 0.025

# 0.5 -- 0.63 2 0.016 -- 0.02

$ 0.4 -- 0.5 3 0.013 -- 0.016

% 0.32 -- 0.4 4 0.01 -- 0.013

& 0.25 -- 0.32 5 0.0079 -- 0.01

' 0.2 -- 0.25 6 0.0063 -- 0.0079

( 0.16 -- 0.2 7 0.005 -- 0.0063

) 0.13 -- 0.16 8 0.004 -- 0.005

* 0.1 -- 0.13 9 0.0032 -- 0.004

+ 0.079 -- 0.1 : 0.0025 -- 0.0032

, 0.063 -- 0.079 ; 0.002 -- 0.0025

- 0.05 -- 0.063 < 0.0016 -- 0.002

. 0.04 -- 0.05 = 0.0013 -- 0.0016

/ 0.032 -- 0.04 > 0.001 -- 0.0013

Other symbols indicate lower error probabilities, and "~" is the lowest possible. In general:

Error probability <= 10 ^ -((ASCII value - 33) / 10)

The "mismap" is simply the lowest probability from the "p" line.

Split versus spliced alignment

Here is a split alignment:

Query         ttctttgat--gctagtcctgatgttatggtattttttatcgaatgataa
                |||||||--||||||                |||x||||||||||||
Genome chrA  ...ctttgatatgctagt...             |||x||||||||||||
Genome chrB                                 ...tttatatcgaatgata...

And here is a spliced alignment:

Query        ctagtcgatatt--gctgtacgtctgttagctat-tttttcctctgtttg
                |||x|||||--|||||||||----|||||||-|||||x|||||
Genome chrA  ...gtctatattatgctgtacgt... |||||||-|||||x|||||
Genome chrB                          ...tagctatattttttctctg...

Split alignment allows arbitrarily large unaligned parts in the middle of the query, whereas spliced alignment applies a standard gap penalty. (Both allow arbitrarily large unaligned parts at the edges of the query.)

For DNA queries, you might wish to try "trans-spliced" alignment without considering splice signals:

lastdb -m1111110 db genome.fasta
lastal -Q1 -e120 db q.fastq | last-split -c0 > out.maf

Going faster by parallelization

With large datasets, it's important to go faster by using multiple CPUs. One way to do that is by using GNU parallel (http://www.gnu.org/software/parallel/):

parallel --pipe -L4 "lastal -Q1 -e120 db - | last-split" < q.fastq > out.maf

Beware that older versions of GNU parallel were slow when using --pipe -L, so be sure to use a recent version.

Options

-h, --help Show a help message, with default option values, and exit.

-g, --genome=NAME

Do spliced alignment, and read splice signals (GT, AG, etc) from the named genome. NAME should be the name of a lastdb database.

-c, --cis=PROB Do spliced alignment, and set the average probability per base of cis-splicing. The default value roughly fits human RNA.

-t, --trans=PROB

Do spliced alignment, and set the average probability per base of trans-splicing.

-M, --mean=MEAN

Do spliced alignment, and set the mean of ln(intron length). The default value fits human RNA.

-S, --sdev=SDEV

Do spliced alignment, and set the standard deviation of ln(intron length). The default value fits human RNA.

-m, --mismap=PROB

Don't write alignments with mismap probability > PROB. Low-confidence alignments will be discarded unless you increase this value!

-s, --score=INT

Don't write alignments with score < INT. The default value is somewhat higher than the lastal score threshold. Specifically, it is e + t * ln(1000), where e is the score threshold, and t is a scale factor that is written in the lastal header. This roughly means that, for every alignment it writes, it has considered alternative alignments with one-thousandth the probability.

-n, --no-split Do probability calculations as usual, but write the original alignments, annotated with "p" lines and mismap probabilities. Note that the mismap and score limits still apply.

-v, --verbose Show progress information on the screen.

-V, --version Show version information and exit.

Details

The input must be in MAF format, and it must include header lines (of the kind produced by lastal) describing the alignment score parameters.
The program reads one batch of alignments at a time (by looking for lines starting with "# batch"). If the batches are huge (e.g. because there are no lines starting with "# batch"), it might need too much memory.
lastal can optionally write "p" lines, indicating the probability that each base is misaligned due to wrong gap placement. last-split, on the other hand, writes "p" lines indicating the probability that each base is aligned to the wrong genomic locus. You can combine both sources of error (roughly) by taking the maximum of the two error probabilities for each base.
The program assumes that the same score parameters were used for all alignments. So it is incompatible with the recipe in the bisulfite document.

To do

An option to specify splice signals and their strengths.

Symbol	Error probability	Symbol	Error probability
`!`	0.79 -- 1	`0`	0.025 -- 0.032
`"`	0.63 -- 0.79	`1`	0.02 -- 0.025
`#`	0.5 -- 0.63	`2`	0.016 -- 0.02
`$`	0.4 -- 0.5	`3`	0.013 -- 0.016
`%`	0.32 -- 0.4	`4`	0.01 -- 0.013
`&`	0.25 -- 0.32	`5`	0.0079 -- 0.01
`'`	0.2 -- 0.25	`6`	0.0063 -- 0.0079
`(`	0.16 -- 0.2	`7`	0.005 -- 0.0063
`)`	0.13 -- 0.16	`8`	0.004 -- 0.005
`*`	0.1 -- 0.13	`9`	0.0032 -- 0.004
`+`	0.079 -- 0.1	`:`	0.0025 -- 0.0032
`,`	0.063 -- 0.079	`;`	0.002 -- 0.0025
`-`	0.05 -- 0.063	`<`	0.0016 -- 0.002
`.`	0.04 -- 0.05	`=`	0.0013 -- 0.0016
`/`	0.032 -- 0.04	`>`	0.001 -- 0.0013

`-h, --help`	Show a help message, with default option values, and exit.
`-g, --genome=NAME`
	Do spliced alignment, and read splice signals (GT, AG, etc) from the named genome. NAME should be the name of a lastdb database.
`-c, --cis=PROB`	Do spliced alignment, and set the average probability per base of cis-splicing. The default value roughly fits human RNA.
`-t, --trans=PROB`
	Do spliced alignment, and set the average probability per base of trans-splicing.
`-M, --mean=MEAN`
	Do spliced alignment, and set the mean of ln(intron length). The default value fits human RNA.
`-S, --sdev=SDEV`
	Do spliced alignment, and set the standard deviation of ln(intron length). The default value fits human RNA.
`-m, --mismap=PROB`
	Don't write alignments with mismap probability > PROB. Low-confidence alignments will be discarded unless you increase this value!
`-s, --score=INT`
	Don't write alignments with score < INT. The default value is somewhat higher than the lastal score threshold. Specifically, it is e + t * ln(1000), where e is the score threshold, and t is a scale factor that is written in the lastal header. This roughly means that, for every alignment it writes, it has considered alternative alignments with one-thousandth the probability.
`-n, --no-split`	Do probability calculations as usual, but write the original alignments, annotated with "p" lines and mismap probabilities. Note that the mismap and score limits still apply.
`-v, --verbose`	Show progress information on the screen.
`-V, --version`	Show version information and exit.